snp2prot: a tool to map
human DNA variation onto proteins
snp2prot maps SNPs onto known human proteins on the basis of their flanking sequences. The DNA sequence is translated in six frames and looked for in the proteins from the human proteins subset of SWALL database.
DNA sequence

Variation position   Second variant 

  
Remarks:

DNA sequence may be in a raw or FASTA format and may contain whitespaces and digits. Example: 

DNA sequence:       ATGCCAACCTCAACCTGACCGTGGACGAGGGTGTCCAGGTGGCCAAGTACT
Variation position: 26
Second variant:     T
You may find it more convenient to separate the flanks from the polymorphic position by spaces.

snp2prot requires that at least one translated flanking sequence should have an exact 7 a.a. match with a database protein sequence. In case this match has been detected, it further requires that the second flanking sequence has either exact match with the protein sequence or matches the protein sequence in all positions until the end of the protein or conventional exon/intron border is observed. The mapping quality is indicated for each query:

LR, both flanks completely match the protein sequence;
L?, exact match of left flank and partial match of the right one;
?R, vice versa

Taking in view the mapping requirements, we recommend that the flanks you provide are 25-30bp each.